Learn More
Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO501
Description
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)

Specifications
Forward Sequencing Primer | |
Dry Ice | |
pJET | |
pJET1.2 | |
Liquid |
T3 promoter Sequencing Primer, 24-mer, 10 μM Store at –20°C. |
|
10 μM | |
10 μM | |
Sequencing |
Product Suggestions
Customers who viewed this item also viewed
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.