Learn More
Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.
Brand: Thermo Scientific™ SO511
45.00 EUR valid until 2024-12-31
Use promo code "21651" to get your promotional price.
Description
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)
Specifications
Forward Sequencing Primer | |
Dry Ice | |
pJET | |
pJET1.2 | |
Liquid |
pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL) Store at –20°C. |
|
10 μM | |
10 μM, 84 μL | |
Sequencing |
Your input is important to us. Please complete this form to provide feedback related to the content on this product.
For Research Use Only. Not for use in diagnostic procedures.